1.4 Mutationen, Mutagene
1.4.1 Genmutation, Ursachen und Auswirkungen von Basenmutationen, DNA-Reparatur

 

Die bisher besprochenen Vorgänge um die Verdopplung des Erbguts (Replikation) und die Realisierung der genetischen Information (Transkription, Translation) sind alle höchst kompliziert und bedürfen eines gewaltigen Aufwandes an Energie und Material in der Zelle. Dabei geschehen spontan Fehler. Spontane oder induzierte Änderungen des Erbgutes werden als Mutationen bezeichnet.

Wird z.B. ein Gen falsch abgeschrieben, ensteht ein modifiziertes oder sogar defektes Protein, was sich in einem veränderten Stoffwechsel oder als Krankheit äußert. Man nennt solche Mutationen Genmutationen.

Sichelzellanämie als Genmutation

In Abb. 77 ist das Hämoglobin-Molekül abgebildet. Eine Genmutation im Gen der ß-Kette sorgt für eine veränderte Hämoglobinstruktur, sichelzellartig verformte Erythrocyten (siehe Abb. 77) und eine schlechte O2-Speicherung.

Man bezeichnet diese Krankheit als Sichelzellanämie. Sie tritt fast nur bei der schwarz-afrikanischen Bevölkerung auf. In den USA kann man die Häufigkeit des Auftretens der Abbildung entnehmen.

Bei der schwarzen Bevölkerung tritt sie homozygot 1:400 und heterozygot 1:12 auf. In den Malariagebieten Afrikas findet man sehr häufig die heterozygote Form, da die Sichelform der Erythrozyten den Infektionszyklus des Malaria-Erregers behindert und so dem Merkmalsträger eine Resistenz verliehen wird.
Homozygot ist das Krankheitsbild u.a. von Anämie und Verstopfung der Blutgefäße gekennzeichnet.

Genetische Ursache:

Bei der Sichelzellanämie ist in der b-Kette in Position 6 die Base A (GAG = Glutaminsäure) gegen T (GTG = Valin) ausgetauscht. Das Hämoglobin besitzt deshalb eine andere Konformation. Man bezeichnet eine solche Änderung nur einer Base als Punktmutation. Man spricht ebenfalls von einer Fehlsinn-Mutation, da die genetische Information. geändert wurde.

 

Brustkrebs als Genmutation

Brustkrebs (Mammakarzinom) ist ein bösartiger Tumor der Brust, der gewöhnlich in in den Geweben der Milchdrüsenkanäle oder -drüsenläppchen entsteht. Brustkrebs ist in Deutschland die häufigste Krebsart und auch die häufigste Krebstodesursache bei Frauen. Jeder vierte bösartige Tumor bei Frauen ist Brustkrebs. Jährlich erkranken 43.000 Frauen uns ca. 400 Männer an Brustkrebs. Bundesweit starben 2001 ca. 19.000 Frauen an Brustkrebs. 60 Prozent der Erkrankungen erfolgen erst nach dem 60. Lebensjahr.

Alle Tumoren der Brust können grob in Milchgangskarzinome, auch duktales Karzinom, und in Läppchenkarzinome auch lobuläres Karzinom unterschieden werden. (siehe Abb. 80) Nachfolgend einige häufige Karzinome:

Art des Brustkrebses Häufigkeit in %
infiltrierend duktales Karzinom 75
Kolloidkarzinom 15
lobulär invasives Karzinom 10
tubuläres Karzinom selten
adenozystisches Karzinom selten
papilläres Karzinom selten

5 -10 % der Brustkrebserkrankungen sind erblich und werden durch autosomal dominante Mutationen in bestimmten Genen wie BRCA1 (Chromosom 17) oder BRCA2 (Chromosom 13) verursacht. Diese Gene werden auch Tumor - Suppressor-Gene genannt. (Suppressor = Unterdrücker)
Die weiblichen Geschlechtshormone (Östrogene) begünstigen das Wachstum gewisser Brustkrebstypen.

Das BRCA1-Gen wurde 1990 entziffert. Es besteht aus 5,592 Nucleotiden verteilt in 24 Exons verteilt in 81 Kilobasen (kb) DNA. Das Genprodukt (Protein) ist 1863 Aminosäuren lang und bindet Zink. Es spielt eine wichtige Rolle im Zellzyklus im Zusammenhang mit Genaktivierung und DNA-Reparatur.
Das Gen wird in allen Geweben transcribiert.

Das BRCA2-Gen wurde 1994 identifiziert, besteht aus 11,385 Nucleotiden in 27 Exons verteilt in 70 kb des Chromosoms 13. Das Genprodukt besteht aus 3418 Aminosäuren. Es ist an der DNA-Reparatur von Chromosomenpaaren bei Strangbrüchen beteiligt. Eine Mutation oder ein Ausfall führt zu Krebs, in anderen Zellen als des Brustgewebes führt ein Defekt zu Eierstockkrebs und Bauchspeicheldrüsenkrebs.

Man kennt heute über 235 Mutationen in BRCA1 und mehr als 100 Mutationen im BRCA2-Gen.

In Abb. 84 ist das Krebsrisiko für 3 Mutationen im BRCA1-Gen zusehen. Ein Ausfall oder eine Beschädigung der an der DNA-Reparatur beteiligten Gene führt also immer mit steigendem Alter zu einer Zunahme des Krebsrisikos. Ein Strangbruch vor dem p53-Gen und der Ausfall der BRCA-Gene sorgt für unkontrollierte DNA-Replikation und Zellwachstum (Tumor), Anhalten des Zellzyklus in der G1-Phase und der Apoptose.

Viele weitere Krankheiten bei Mensch, Tier und Pflanze beruhen auf Genmutationen:

Sichelzellanämie, Phenylketonurie, Alkaptonurie, Albinismus, Zellweger Syndrom, Marfan Syndrom usw.

Doch nicht immer wirkt sich eine Genmutation negativ aus.

HIV-Resistenz als Genmutation


Ca.1% der Menschen in Europa sind immun gegen eine Infektion des HIV-Virus. Untersuchungen ergaben, daß diese Personen auf
Chromosom 3 zwei defekte (mutierte) Gene des T-Zell und Makrophagen-Rezeptors CCR5 (= Chemokiner (C-C) Rezeptor 5) besitzen. Dieser ist als Korezeptor mit dem CD4-Rezeptor für die Injektion der HIV-Nukleinsäure in die Wirtszelle notwendig. Diese Menschen besitzen also eine homozygote Mutation, d.h. auf beiden Chromosomen sitzt das mutierte Gen.

Der CCR5-Rezeptor gehört zu den G-Protein gesteuerten 7-Helix-Transmembran-Rezeptoren, die bei Immunreaktionen für die Signalübertragung mit Chemokinen (z.B. Interleukine) notwendig sind. Die Stimulation über diesen Rezeptor lösen bei Neutrophilen, Basophilen, Eosinophilens, Lymphocyten und Makrophagen eine Wanderung zum Infektionsort aus.

Nachfolgend ist die Situation dargestellt.

 

 

 

 

 

 

 

 

 

Abb. 77

S-Hämoglobinmolekül

Sichelzellanämie
normale und sichelzell-Erythrozyten

 

 

 

 

 

 

Abb. 78

Sichelzellanämie in den USA

 

 

 

 

 

 

 

Abb. 79

Punktmutation

 

 

 

 

 

 

Abb. 80

Anatomie der Brust

Drüsenläppchen (Lobuli)
Brustwarze (Mamilla)
Warzenhof (Areola)
Kanäle (Ductus)

Autosomal =
die Nichtgeschlechtschromosomen betreffend, also 1 -22 beim Mensch)

dominant:
das gesunde Merkmal überdeckend

BRCA:
BReast CAncer- 1 und 2

 

Abb. 81

Mutation im BRCA-Gen


 

Abb. 82

Mutationen in BRCA-Genen

Krebsrisiko

 

Abb. 83

DNA-Reparatur durch BRCA2

ATM = Kinase
p53 = kritisches Checkpoint Gen
PCNA = proliferating cell nuclear antigen

Abb. 84

Krebsrisiko für 3 Mutationen

 

Abb. 85

Mammogramm

Tumor

 

 

 

 

 

 

 

 

 

 

 

 

 

Das HIV-Virus benötigt zu seiner Infektion neben dem CD4-Rezeptor u.a. den CCR5 Korezeptor. Normalerweise besitzt der Mensch homozygot 2 Kopien des CCR5-Gens, das für den CCR5-Rezeptor verantwortlich ist. Er ermöglicht mit dem CD4 zusammen die Adsorption und Infektion (a). Nun gibt es einige Individuen, die bezüglich diese Gens einen homozygoten Defekt zeigen, d.h. beide Gene sind defekt und führen zu einem defekten Protein (b), das keine Infektion ermöglicht (c).

Aus der Gendatenbank können wird die Sequenz des CCR5-Gens entnehmen (komplementäre DNA-Sequenz; entspricht der mRNA des Gens mit T statt U)

Nukleotidsequenz des CCR5 Gens:

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGG
CTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
CATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCAT
CTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACT
CTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATC
ATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTC
CAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG
GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTC
GGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTC
TGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCC
GATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

Das mutierte Gen CCR5 Mutant hat folgende Sequenz:

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAG
GCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
CATTTTCCATACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGT
CATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGA 

Der Nukleotidvergleich zeigt, daß ungefähr ab der Mitte des Gens die Sequenz verändert ist und dann ganz fehlt. Man nennt solche Löschungen von Teilen von Genen oder Chromosomen Deletion.

Neben der Deletion gibt es noch andere Genmutationstypen. Wir wollen uns deshalb nocheinmal das menschliche Hämoglobingen genauer betrachten. Hier treten u.a. in der Beta-Kette verschiedene Mutationen auf.

 

 

 

Abb. 86

HIV-Resistenz am CCR5-Gen

schwarz:
Normales Gen ist mit mutiertem Gen identisch

rot:
zum mutierten Gen unterschiedliche Nukleotidsequenzen

(ATG = Startercodon)

 

 

 

 

 
 

 

Die Sichelzellanämie als Punkt- oder Fehlsinnmutation hatten wir schon besprochen. Bei der Thalassämie werden zu wenig intakte Betaketten des Hämoglobins gebildet, da die Proteinproduktion durch die Rastermutation abbricht und zu einem defekten Protein führen. Die Folge sind deformierte rote Blutkörperchen, Sauestoffmangel und viele organische Defekte. Sie kann entweder durch eine Nonsens-Mutation oder eine Rastermutation verursacht werden.

Bei der Nonsens-Mutation entsteht ein Stop-Codon, was zu einem Abbruch der Proteinsynthese und einem unvollständigen und nicht-funktionierenden Hämoglobin führt. Bei der Rastermutation fehlen zwei Basen (AA), was das Triplett-Raster so verschiebt, daß total andere Codogene entstehen und damit falsche Aminosäuren eingebaut werden, was ebenfalls zu einem defekten Hämoglobin führt.

Die Thalassämie kann die a-Kette ( a-Thalassämie) oder die b-Kette ( b-Thalassämie) des Hämoglobins betreffen.

Das Hämoglobin besitzt bekanntlich 2 a-Ketten und 2 b-Ketten (siehe oben). Das Gen für die b-Kette sitzt auf dem Chromosom 11. Das Chromosom 16 besitzt 2 Gene für die a-Ketten. Thalassämie entsteht, wenn ein Hämoglobingen defekt ist. Eine leichte Anämie und verkleinerte Erythrozyten treten erst auf, wenn 2 Gene defekt sind. Der Ausfall aller 4 Globin-Gene führt zum embryonalen Tod. a-Thalassämie tritt vornehmlich in Asien und Afrika auf.

Zusammenfassung der Genmutatationen

Der häufigste Mutationstyp sind Basenpaarungs-Mutationen. Er tritt auf, wenn eine Base ausgetauscht wird, was zu einer falschen Basenpaarung führt, z.B. A wird zu G oder T zu C. Die Folgen sind in der nachfolgenden Tabelle aufgeführt.

 

 

 

 

 

Abb. 87

Rastermutation - Thalassämie



Blutbild mit Thalassämie



Verbreitung der Thalassämie

 

Abb. 88

Hämoglobingene

 

 

 

Stille Mutationen

Meist wird die 3. Base durch eine andere ersetzt, sodaß sich die Basenpaarung zwar ändert, aber wegen des degenerierten Codes bei der Transkription kein anderes Codon entsteht.

 

Fehlsinn-Mutationen

Der Basenaustausch führt zu einem anderen Codogen, was letztendlich zu einer anderen Aminosäure führt. (Sichelzellanämie)

 

 Nonsens-Mutationen

Durch Basenaustausch entsteht eines der drei Stop-Codone. Dies führt zu einem defekten Protein. (cystische Fibrose)

 

 Raster-Mutationen

Durch Einfügen oder Löschen einer Base wird das Triplettraster verändert. Bei der Transkription entsteht so ab der mutierten Stelle eine mRNA mit anderen Codonen, was zu einem nichtfunktionierenden Protein führt. (Huntingtonsche Krankheit)

 

 

 

Genommutation

Auch bei der Verteilung der Chromosomen bei der Zellteilung können Fehler auftreten, z. B. können die Chromosomen ungleichmäßig auf die neuen Zellen verteilt werden. Eine der neu entstandenen Zellen besitzt nun 1 Chromosom zuviel.

In Abb. 89 ist ein solcher Fall abgebildet, das Karyogramm eines Menschen mit dem Karyotyp (47, XY, t21). Diese Erbkrankheit hat Folgen für den gesamten Organismus.

Man nennt das Krankheitsbild Down-Syndrom (siehe Abb. 90). Die Krankheit tritt bezüglich der lebend geborenen 1:700 auf. Da bei dieser Krankheit die Anzahl der Chromosomen betroffen ist, bezeichnet man diese Form der Mutationen als Genommutationen.

Chromosomenmutation

Als dritten Typ Mutation findet man in vielen Organismen Änderungen der Chromosomenform, z.B. ein verkürztes oder ein ringförmiges Chromosom. Solche Mutationen nennt man Chromosomenmutationen. Die Abb. 91 zeigt eine Verkürzung des Chromosoms (Deletion) und eine Zyklisierung.

Bei Drosophila ist z.B. die Bar-Mutante, die eine veränderte Augenform besitzt auf eine Deletion der Bar-Gene zurückzuführen. (siehe Abb. 91)

Insgesamt kennt man also 3 Mutationsformen:

Im Kapitel klassische Genetik werden Genommutationen und Chromosomenmutationen ausführlich behandelt.

 

 

 

Abb. 89

Downsyndrom

 

Abb. 90

Chromosomenmutationen


Zyklisierung


Deletion

 

Weiterführende Quellen:

genetischer Code

http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/Codons.html
http://www.amsci.org/amsci/issues/Comsci98/compsci9801.html

Bustkrebs

http://www.hosppract.com/genetics/9710gen.htm
http://www.genomenewsnetwork.org/articles/09_02/breast_gene.shtml
http://www.krebshilfe.de/neu/presse/pm-detail.php?Nr=426

Sichelzellanämie

http://www.defiers.com/scd.html

HIV, CCR5 http://www.critpath.org/aric/library/art004.htm

Thalassämie

http://www.med-ed.virginia.edu/courses/path/innes/rcd/thalassemia.cfm